Undergraduate Research Committee

The Bioremediation of Polyethylene, Polyurethane, Polypropylene and Polystyrene by Aspergillus Niger and Bacillus Subtilis

As the manufacturing and consumption of plastics has continued to increase over the years, plastic debris poses a huge threat to many ecosystems. The amount of plastic accumulating in the environment has been steadily increasing as a result of plastic durability and lightweight nature (1). An estimated 300 million tons of plastic are produced and used yearly (1). Plastics are man-made materials manufactured from polymers or long chains of repeating molecules derived from oil, natural gas, and plants such as corn and sugarcane. In addition to replacing steel in cars, and wood in furniture, plastics have replaced paper and other cellulose-based products for packaging. Biodegradation of these abundant plastics may be the key to controlling this problem (1). A more efficient technique of plastic degradation may be achieved, by understanding the mechanism of polymer degradation. This requires researchers become familiar with how compounds are metabolized by existing organisms, as well as identifying new organisms capable of biodegradation and characterizing their metabolic abilities (2). Biodegradation is a complex natural process to decompose substances and involves several steps: 1) fragmentation of materials into smaller functions (bio-deterioration); 2) secretion of free enzymes and free radical species to cleave oligomers, dimers and monomers (depolymerization), 3) recognitions and reorganization of select molecules (assimilation), and 4) oxidation of simple molecules, and salts from metabolites (mineralization) (3). While a number of bacteria have been found to be excellent at biodegradation relatively few fungi have been identified as capable of plastic decomposition. Polyethylene, polyurethane, and polystyrene are the predominant types of plastics used in industry and manufacturing, and all have shown susceptibility to biodegradation (2). Plastics are polymers generated by the condensation of polyisocyanate resulting in a carbon polymer composed of urethane linkages (2). Alterations in the spacing between urethane linkages, as well at the substitutions, can change the properties of the resulting polymer from linear and rigid to branched and flexible (2). Microorganisms in prolonged contact with plastic wastes have been found to adapt and maximize their degradation potential (4). These microorganisms are “reported to produce some special enzymes viz. intracellular and extracellular, which enable the microbes to disintegrate the polymer into several monomers and dimers, which are being used by the microbes as a carbon source” (7). In this study, special interest will be paid to Aspergillus niger, and Bacillus subtilis for their ability as known degraders. Baseline growth and bioremediation potential of these organisms both on their own and in consortia will be observed against a variety of plastic substrates (polyethylene, polyurethane, polypropylene, and polystyrene). Activity of the microorganisms against the plastic substrates will be observed in the laboratory setting. Understanding the detailed metabolism of the organisms which naturally degrade plastics may shed light on the challenges of removing plastic waste to preserve our environment. Growth Establishment A 6mL starter culture of Bacillus subtilis will be prepared using nutrient broth and placed in the shaking incubator for 24 hrs at 30 ℃ and 220 rpm. 100 μL of the starter culture will be spread on a nutrient agar plate and incubated for 24 hrs at 30 ℃. Two single colonies will then be picked from the plate and a separate glycerol stock will be made for each colony. Aspergillus niger will be rehydrated using 6 mL sterile distilled water and allowed to sit for 24hrs. 100μL of the starter culture will be spread on a Sabouraud Dextrose Agar (SDA) along with 100mg/mL ampicillin plate and incubated at 37 ℃ until growth is observed, 2 weeks, for fungi (2.3.5). Two single colonies will then be picked from the plate and a separate glycerol stock will be made for each colony. Bioremediation Tests Sheets of polyethylene and polyurethane, and shavings of polypropylene and polystyrene will be rinsed with sterile water, dried, weighed and sterilized with 70% Ethanol (4). Establishment of baseline bioremediation properties will be done with nutrient broth for Bacillus subtilis and Sabouraud Dextrose broth with ampicillin for Aspergillus niger. 1g of polyethylene, polyurethane, polypropylene or polystyrene will be added to the culture and growth will be carried out at 30 ℃ for Bacillus subtilis and 37 ℃ for Aspergillus niger for up to six weeks. The plastic sheet or shavings will be removed, cleaned with 70% ethanol and deionized water, dried in the oven for one hour, and weighted every 2 weeks. Once weighted the sheet or shavings will be added back to the culture. From there the degradation can be measured by the weight reduction of the dry samples. Three replicates will be done of polyethylene, polyurethane, polypropylene, and polystyrene with Aspergillus Niger, and Bacillus Subtilis. In addition to the negative control, which will contain only ampicillin in synthetic media, a positive control which contains each type of plastic with ampicillin in synthetic media will be prepared. The controls should show no fungal or bacterial growth and no weight reduction due to degradation. Bioremediation by fungi will be carried out in synthetic Czapek Dox broth (pH 6.8, 100 mg/mL ampicillin) (6). Bioremediation by bacteria will be carried out in Davis broth, a minimal ingredient medium (6). 1g of polyethylene, polyurethane, polypropylene or polystyrene will be added to the culture and growth will be carried out at 30 ℃ for Bacillus subtilis and 37 ℃ for Aspergillus niger for up to six weeks. The plastic sheet or shavings will be removed, cleaned with 70% ethanol and deionized water, dried in the oven for one hour, and weighted every 2 weeks. Once weighted the sheet or shavings will be added back to the culture. From there the degradation can be measured by the weight reduction of the dry samples. Three replicates will be done of polyethylene, polyurethane, polypropylene, and polystyrene with Aspergillus Niger, and Bacillus Subtilis. In addition to the negative control, which will contain only ampicillin in synthetic media, a positive control which contains each type of plastic with ampicillin in synthetic media will be prepared. The controls should show no fungal or bacterial growth and no weight reduction due to degradation.

Comparing Litter Decomposition Across a Gradient of Wetland Health

Background: Coastal wetlands are a vital part of the Great Lakes (Uzarki et al. 2019), by providing habitat, nutrients, fisheries and biodiversity to the ecosystem (Wetzel 1992, Brazner et al. 2000 and Wei et al. 2004). Many species rely on these wetlands for crucial nursery habitat, such as the yellow perch (Parker et al. 2012). In addition to benefiting the ecosystem, coastal wetlands have been estimated to produce 69 billion USD annually to the economy surrounding the Great Lakes (Krantzberg et al. 2008). In the past 100 years, human activities have caused a depletion of wetland habitat by over 50% (Krieger et al 1992) and these activities continue to threaten the remaining wetlands (Trebitz et al. 2007). For the past decade, the US EPA’s Great Lakes monitoring program has been assessing wetland health. The monitoring program has based its categories of wetland health largely on what species can or cannot be found there (Uzarki et al. 2019). This only accounts for the structure of the wetland and doesn’t represent the entire workings of its ecosystem. A functional indicator can aid in determining how it is working or how healthy it is based on its function (Sandin et al. 2009). One common way to test an ecosystem’s functional health, is to measure the rate of plant decomposition (Young et al. 2008, Udy et al. 2006 and Lamberti et al. 2017) because this function is affected by water quality and bacterial communities. Objective: The objective of my senior research is to assess whether current categories of wetland health correspond with the ecosystem’s functional health. This will be done using decomposition across a gradient of wetland health. As an alternative measurement, the number of bacteria feeding on the plant matter will be assessed. I hypothesize that the rate of litter decomposition will be quicker in higher quality wetlands compared to lower quality, and that microbial respiration will be higher in high quality wetlands compared to low quality. Overview of Methods: Litter decomposition will be measured in 12 wetlands during the summer, with 3 categories of health: high, medium and low across the St. Mary’s River, located in the Eastern Upper Peninsula of Michigan. Health categories will be determined using values assigned by the Great Lakes Coastal Wetland Monitoring program based on macroinvertebrates and fishes. Cattails will be used as the plant material as it is commonly found in the coastal wetlands. At least 156 mesh bags will be constructed from 1.27 mm mesh sheets: 20 x 20 cm (Benfield 1996), and each site will contain 13 bags. Ten grams of dried cattail will be weighed and placed in each mesh bag (Lamberti et al. 2017). Bags will be labelled with plastic tags, sealed with a vacuum sealer and tied onto rebar using braided fishing line. (Anderson et al. 2002). Six retrieval periods will take place every few weeks before the water freezes over. Three more retrieval periods will be completed after the ice melts next spring. Once mesh bags are retrieved, they will be dried, weighed, ashed, and re-weighed to determine loss of organic material (i.e., decomposition). The rate of mass loss over time will be used to calculate decomposition rate. On the 6th retrieval, the bacterial community on the plant material will be measured for each wetland. This will be done by measuring the rises and drops in oxygen during periods of light and dark incubation. During the light, photosynthesis will occur, and oxygen levels rise. During the dark, respiration will occur, and oxygen levels fall. Incubation will take place in Ashmun Bay to regulate temperature and sunlight the following morning of retrieval. Dark totes will be placed over light totes and then litter bags will be placed within the totes. This will allow the bags to be exposed to light and dark conditions without moving the bags. One of the tote sets will not contain any mesh bags and will serve as a control of microbial respiration without the litter. DO (dissolved oxygen) loggers will be placed in each shoe box tote to measure DO changes every 30 minutes. Changes in dissolved oxygen during the “dark” period and “light” period will be used to calculate respiration rates for each treatment. An ANCOVA test will be used to differentiate the loss of mass among wetland types over time. The mass loss would be the dependent variable, wetland type is the independent variable, and time is the covariate. The bacterial community gross primary production (GPP) will be calculated adding the oxygen change during the dark (R) by the oxygen change during the light (NPP). Respiration differences across wetland type and time will also be tested using an ANCOVA.

Macroalgae  in Saltwater Aquaponic Systems Reduce Nutrients in Effluent

Saltwater aquaponics is a relatively new area of study as a majority of systems are freshwater. However with growing concern over the lack of freshwater in many countries this setup is becoming the new way to farm in an effort to conserve drinking water and bring food to these areas. Aquaponics is known to conserve over 90% of water and be the sustainable way to raise two food sources that work together. However, effluent from these systems can cause eutrophication in watersheds as well as increase the salinity of the soil when not properly handled. Recent publications as of this year began to look at IMTAs or integrated multi-trophic aquaculture systems as a model in reducing the nutrient load of effluent. The idea of this system is to have three layers from a primary producer all the way to a primary consumer in an effort to reduce the solids into workable energy for macroalgae. IMTA systems have been studied in open ocean settings where they have found that the waste within the round-pens significantly decreased compared to pens without. They also found that the macroalgae grew much faster in this setting than it did on its own in similar growth pens without fish. Therefore, taking this multi-level system to land based shrimp farms could solve their excess nutrient effluent problem while in turn creating multiple avenues for business. To represent the aquaponic system set up each aquarium will have Salicornia europaea, a plant that will aid in nutrient testing as well. These species of plants do not like excess nutrients and have found to grow when there was not an abundance of phosphate or nitrogen in the water. Therefore, their growth rate will be another test outside of basic chemistry testing to see how much nutrients are in the water. This halophyte, or salt marsh plant, is just as much of a delicacy as nori seaweed is in the culinary world. Overall, finding that macroalgae can reduce nutrients in saltwater aquaponic systems there will be possibilities of expanding the field and reducing effluent waste.

Prevalence of Caspase -9 Mutations in the Lung Cancer Population of the Eastern Upper Peninsula

“Cancer is known for being the leading cause of deaths worldwide annually. While being the second most common diagnosed cancer, “lung cancer is the leading cause of deaths worldwide” (Mayo Clinic, 2021). Lung cancer is a type of abnormal cell growth that occurs in the lungs. To put into perspective, almost ten million cancer patients died in 2020, while nearly two million of those deaths were caused by lung cancer (Sung, H., et al., 2021). Therefore, identifying different causes to lung cancer should be prioritized. Today we know there are vast amounts of carcinogens in the world. Carcinogens are environmental factors that cause cancer. One example of this would be cigarettes. In fact, smoking is the best-known cause of lung cancer. On the other hand, lung cancer can also occur in patients’ who have never smoked. This leads to more background research such as; genetic history and other environmental factors to identify causes. Cancer is the development of tumors caused by rapid, uncontrolled proliferation of cells in the body. What causes these cells to rapidly proliferate? The development of cancer, is considered a multiple step process at the cellular level (Cooper, 1970). Mutations are the first step leading into any cancer development. These mutations affect cell division by altering how many proteins are present and their function of regulating how the cells grow, divide and how the protein repairs DNA (Gale, 2020). Once the mutation alters the DNA, continual replication of the altered DNA will occur. This can lead to mass cell division of the abnormal cells causing tumors. One type of mutation causes a proto-oncogene to convert to an oncogene. Proto-oncogenes promote cell growth and the differentiation of cells. This can be viewed as cell activity. When a proto-oncogene is mutated into an oncogene it can be over-active leading to excessive cell proliferation (Gale, 2020). Another type of mutation causes inactivation of tumor suppressor genes. The healthy tumor suppressor genes are part of the cellular balance that promotes apoptosis and inhibits cell division. Balancing the cells growth and death maintains a healthy body. The alteration of apoptosis caused by oncogenes and mutated tumor suppressor genes is the focus of this study. Apoptosis is programmed cell death, and the alterations to apoptosis are highly recognized in affects to human cancers (Olsson and Zhivotovsky, 2011). This form of cell death is controlled by caspases and other regulatory factors. There are a series of caspase genes, ordered by number and categorized into groups based off function. The focus of this study will be towards group II, since it is responsible for apoptosis. Group II is then split into two classes: “initiator (apical) caspases (caspase-2, -8, -9 and -10) and effector (executioner) caspases (caspase-3, -6 and 7)” (Olsson and Zhivotovsky, 2011). In short, the initiator caspase sends off an enzyme that signals the effector caspase to target specific proteins of the unhealthy cell to initiate apoptosis. To specify for this research, the focus will be on the initiator caspase, caspase-9, and polymorphisms or gene alterations that occur to it. There are several polymorphisms or mutations that occur in the caspase genes. Alterations of the caspase genes have been correlated to causing multiple types of cancer as well as lung cancer. Therefore, finding specific mutations linked to specific cancers is difficult. In studies specified to caspase-9 gene alterations, there is a lot of research on polymorphisms rs4645978 and rs4645981 and their link to lung cancer. A few studies have shown a possible correlation, more specifically of the rs4645981 polymorphism to lung cancer. For example, one study suggests a possible correlation to the development of lung cancer (Park, J., et al., 2006). In another study, three polymorphisms of different caspase genes were looked at, and were associated to with the risk of lung cancer (Lee, S.Y., et al., 2010). The possible link between the caspase-9 polymorphisms and lung cancer, could be steps toward finding the other causes of lung cancer. Therefore, the focus of this research will be on finding more data of polymorphisms on the caspase-9 gene in a population that could possibly be correlated to lung cancer. Methods: ​This study will be concentrated to the Eastern Upper Peninsula population, with participation of twenty lung cancer patients and twenty non-lung cancer patients as the control. Lung cancer patients will be identified by War Memorial Hospital Oncology department, and asked if they are interested in participating in the study. A waiver will be given to each participant, explaining the study and noting that identity of participants will not be traced from DNA sample. Each signed waiver will have a code number that matches with the number on a given swab, to keep identities anonymous. The participants will swab the inside of their cheek and place swab back into wrapping, for later testing. The swabs will then be taken to the LSSU lab where DNA extraction and amplification via PCR will take place. ​DNA amplification of the caspase-9 gene will be performed, using polymerase chain reaction (PCR). PCR using specific primers to make copies of targeted regions of the subject DNA. Each cycle doubles the amount of DNA copied. After 25-30 cycles there could be @ one billion copies. This can be repeated for several duplications of the same segment (National Human Genome Research Institute, 2020). Following previous studies, the PCR products will be sent out to Psomagen Inc. to sequence the DNA, to look at several mutations instead of just the two mentioned (Lee, S.Y., et al., 2010). Due to pricing, sending samples to be sequenced is considered the best option for analysis. ​After the DNA sequencing is completed, the base sequence can be analyzed. Each group will be analyzed through a paired T test. This will compare the prevalence of rs4645978 and rs4645981 that occurred in the control group to the prevalence in the lung cancer patients. Once the prevalence can be compared, the total mutation occurrence can be calculated for the population studied in the Eastern Upper Peninsula.

LSSU RobotX

The purpose of this research project is to design and develop an Unmanned Surface Vehicle (USV) mobile robot that is capable of completing the autonomous tasks specified by the 2022 Maritime RobotX Challenge. This competition is open to undergraduate and graduate student teams and will be held in Sydney, New South Wales, Australia. In order to complete these required tasks, the USV will need to be able to autonomously identify and localize different maritime objects, follow paths, hold positions, and communicate data to land stations and another mobile robot. The USV must also be able to correct itself in the presence of wind and waves. The RobotX competition directly advances the field of autonomous maritime operations since these task requirements are active research topics in fields such as ocean engineering and maritime mobile robotics. This is important since oceans and seas are highly dynamic environments that account for 71 percent of the Earth’s surface area. Advancing maritime autonomy will ultimately lead to better mapping of Earth’s oceans, improved data collection, and development of autonomous passenger and freight transportation. In order to complete this project, a Wave Adaptive Modular Vessel (WAM-V) has been granted to LSSU Robotics to serve as the base platform for the USV. The WAM-V is a 16-foot long, catamaran-style vessel with a payload capacity of 485 pounds. To meet the project requirements, the WAM-V will need propulsion, remote control, emergency stop, communication, power, vision, acoustic, and guidance, navigation, and control (GNC) systems. The propulsion system is used to move the vessel and will consist of motors and steering mechanisms. The remote control, emergency stop, and communication systems are used to manually control and shut down the vessel. The power system will consist of on-board batteries that will provide power to the other systems of the vessel. The vision and acoustic systems will use technology such as LiDAR, cameras, and hydrophones to provide information about the surrounding environment to the USV, allowing it to make decisions on how it should behave. The GNC system will consist of a computer that runs control software and a programmable circuit board that sends signals to the other systems of the USV. This research project is a School of Engineering and Technology Senior Design Project for Team AMORE (Autonomous Maritime Operations and Robotics Engineering). Team AMORE has six members.  The faculty advisor for the team is Dr. Edoardo Sarda. As a nontechnical requirement for the project, Team AMORE has created the LSSU RobotX Club. This project will give both team and club members the opportunity to be involved in a multidisciplinary mobile robotics project that involves marketing, working with industry professionals, collaborating with international university students, and competing in an international competition.

Competition Between Lactobacillus Acidophilus and Staphylococcus Aureus in Egg Salad at 27 Degrees C

Staphylococcus aureus is the bacteria responsible for 41% of food poisoning outbreaks (Hernàndez-Cortez et al. 2017). In the United States, there are approximately 241,000 cases of Staphylococcal food poisoning annually (Kadariya 2014). S. aureus is a concern as it is tolerant of high salt and sugar concentrations and produces heat resistant toxins (Kataoka et al. 2015, Hu et al. 2018). One to six hours after ingestion of the toxin causes symptoms including vomiting, diarrhea, fever, and cramping (Asao, 2002, Hu et al. 2007, Kim et al. 2011). Potlucks and picnic foods are at risk for S. aureus contamination as they are left at ambient temperature for hours, promoting the growth of bacteria. 30% of the human population carry S. aureus on their bodies and can spread the bacteria through physical contact and respiratory droplets (Argudín et al. 2010, Asao et al. 2003, Kim et al. 2011). Egg salad is a classic picnic food that is susceptible to S. aureus contamination. Competitive microbial growth between Lactobacillus acidophilus and Staphylococcus aureus may affect the growth of colonies. Lactobacillus produces hydrogen peroxide and lactic acid which has been shown to suppress the growth of S. aureus (Dahiya and Speck 1968, Sameshima et al. 1998). As L. acidophilus is commonly found in yogurts, it can be easily incorporated into the egg salad recipe. The objective is to determine the effect of Lactobacillus acidophilus on the growth of Staphylococcus aureus colonies in egg salad at 27°C. Tryptic Soy Broth, Nutrient Agar, Lactobacilli MRS broth, and Lactobacilli MRS agar will be prepared according to the manufacturer’s instructions. S. aureus ATCC 43300 will be obtained from LSSU frozen bacterial stock. The L. acidophilus from the probiotic capsule will be suspended in broth. Gram staining will be done to confirm the identity of the bacteria after streaking for isolated colonies. The egg salad will be prepared according to the recipe. The sample batch of egg salad will be inoculated with both S. aureus and L. acidophilus. The control batch of egg salad will only be inoculated with S. aureus. The two batches will be incubated at 27 °C for six hours to imitate a summer picnic in Sault Ste. Marie. Three sample replicates will be taken from both batches every hour and spread on an agar plate, then incubated for 24 hours. S. aureus colonies on each plate will be identified and counted. The mean and standard deviation will be taken for each of the three replicates. A scatterplot graph for “Average CFU S. aureus/g vs. time incubated (hrs)” will be made to compare the control to the sample (with L. acidophilus). Standard deviation error bars will be included on the graph for each time point. T-tests will be taken at each time point to determine if the difference in number of colonies of S. aureus per gram of egg salad is significant enough to say that L. acidophilus had an effect. Argudín, M.A., M.C. Mendoza and M.R. Rodicio. 2010. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010(2): 1751-1773. Asao, T., Y. Kumeda, T. Kawai, T. Shibata, H. Oda, K. Haruki, H. Nakazawa and S. Kozaki. 2002. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiology and Infection 130(1): 33-40. Dahiya, R.S. and M.L. Speck. 1968. Hydrogen Peroxide Formation by Lactobacilli and Its Effect on Staphylococcus aureus. Journal of Dairy Science 51(10): 1568-1572. Hernàndez-Cortez, C. I. Galma-Martínez, L.U. Gonzalez-Avila, A. Guerror-Mandujano, R.C. Solís and G. Castro-Excarpulli. 2017. Food Poisoning Caused by Bacteria (Food Toxins). Pages 33-72 in Poisoning – From Specific Toxic Agents to Novel Rapid and Simplified Techniques for Analysis. N. Malangu (Editor). Intech Open. Hu., D.-L., G. Zhu, F. Mori, K. Omoe, M. Okada, K. Wakabayashi, S. Kaneko, K. Shinagawa and A. Nakane. 2007. Staphylococcal enterotoxin induces emesis through increasing serotonin release in intestine and it is downregulated by cannabinoid receptor 1. Cellular Microbiology 9(9): 2267-2277. Hu, J., L. Lin, M. Chen and W. Yan. 2018. Modeling for Predicting the Time to Detection of Staphylococcal Enterotoxin A in Cooked Chicken Product. Frontiers in Microbiology. 9 (1536): 1-11. Kadariya, J., T.C. Smith and D. Thapaliya. 2014. Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. BioMed Research International 2014 (827965): 1-9. Kataoka, A., E. Enache, C. Napier, M. Hayman and L. Wedding. 2016. Effect of Storage Temperature on the Outgrowth and Toxin Production of Staphylococcus aureus in Freeze-Thawed Precooked Tuna Meat. Journal of Food Protection 79(4): 620-627. Kim, N.H., A.-R. Yun and M.S. Rhee. 2011. Prevalence and classification of toxigenic Staphylococcus aureus isolated from refrigerated ready-to-eat foods (sushi, kimbab and California rolls) in Korea. Journal of Applied Microbiology 111: 1456-1464. Sameshima, T., C. Magome, K. Takeshita, K. Arihara, M. Itoh, and Y. Kondo. 1998. Effect of intestinal Lactobacillus starter cultures on the behaviour of Staphylococcus aureus in fermented sausage. International Journal of Food Microbiology 41 (1998): 1-7.

Comparing the Effects of Traditional and E-Cigarette Vapor on Candida Albicans Growth and Virulence Factor Expression

Candida albicans is a prevalent and possibly pathogenic yeast found on most human bodies (Kendrick, 2017). While it typically acts as an interdependent fungus that causes the body no harm, an overgrowth of C. albicans may lead to infection and serious diseases known as candidiasis. As defined by the Center for Disease Control (CDC), candidiasis, also known as oral thrush, is an infection in the oral cavity caused by a Candida species. Symptoms include white patches on the inner cheeks, tongue, roof of the mouth and throat, redness or soreness, loss of taste, and pain while eating or swallowing (CDC, 2021). C. albicans and other Candida species are present in the oral cavity of up to 75% of the population (Ruhnke, 2002). Furthermore, a high incidence of C. albicans has been found in hospital settings. It was the most frequently isolated fungal pathogen (59.7%) in hospital environments (Beck-Sague and Jarvis, 1993). C. albicans has many different factors which increase the degree by which it can cause disease, making it more pathogenic that other Candida species. These factors include its attachment style, ability to change form, antifungal drug resistance, ability to congregate, and its secretion of aspartyl proteinase (Sap). This prevalence and widespread makes the study of C. albicans an important focus in the biomedical field. This research project aims to further explore the secretion of aspartyl proteinase (Sap) as an increased pathogenic factor in C. albicans. Sap is an extracellular enzyme that contributes to the nutrient acquisition, invasion, tissue damage, evasion of host response of C. albicans (Naglik, 2003). For example, the secreted proteinase from C. albicans decreases the antimicrobial defense efficacy of human saliva (Kaminishi, 1995), making C. albicans tough to kill in the oral cavity. Specifically, the SAP2 gene is one of the most commonly expressed genes in patients with oral candidiasis. The introduction of traditional cigarettes in the 1960’s fueled a rise in the smoking of tobacco. However, as time passed, more and more research offered evidence on the harmful long-term health effects of cigarette smoking. It has been linked to multiple neurological, cardiovascular, and pulmonary diseases, as well as health problems such as asthma due to second-hand smoke in children (Das, 2003). While there has been a downward trend in their use, in 2019 the CDC estimated 14.0% (34.1 million) of U.S. adults were current cigarette smokers. Recently, electronic cigarettes (e-cigarettes), also known as vapes, have increased in popularity. They are proposed as a safer alternative to smoking, leading to an e-cigarette acceptability increase by the public (Camenga and Tindle, 2018). Like cigarettes, e-cigarettes have turned into a huge market able to sustain many different product brands. When comparing traditional and e-cigarettes, the key differences is the use of tobacco. Traditional cigarettes contain tobacco while e-cigarettes typically do not. This is one of the primary reasons why they are considered “healthier”. Nonetheless, both products still contain nicotine. Nicotine is the primary addictive ingredient in e-cigarette solutions and tobacco products (Walley, 2019). Non-scientific claims are creating confusion in the public’s perception of the health of e-cigarettes. They are in fact hazardous to human health. Their use can cause multiple symptoms in the respiratory, nervous, gastro-intestinal system, etc. (Meo and Asiri, 2014). Yet, according to the U.S. Food and Drug Administration (FDA), 3.6 million youth still continue to use e-cigarettes today. Previous research has determined the effects that cigarette smoke vapor has on C. albicans. These findings are that cigarette smoke condensate promoted C. albicans growth and SAP2 enzymatic activity (Semlali, 2014). Because both methods of cigarette smoking are still widely used today, more research needs to be done to contribute to public health knowledge. The objective of this study is to compare the effects of traditional and e-cigarette smoke vapor on the growth rate and SAP2 gene expression of C. albicans. We hope to relate these findings to the risk of oral candidiasis with otherwise healthy smokers who contain C. albicans in their oral cavity. To perform this experiment, an in house “smoking device” (Baboni, 2009) will be used to collect cigarette smoke condensate (CSC) for a traditional cigarette group treatment. A 5% nicotine Juul pod liquid will be used for the e-cigarette group treatment. A Gas Chromatography Mass Spectrometry (GCMS) analysis will be performed to measure the amount of trace level nicotine in both treatment liquids to ensure equal amounts. A layer of the CSC and the Juul pod liquid will then be applied to 10 yeast peptone dextrose (YPD) agar plates each. A control group with no additive treatment will also be included. C. albicans will be suspended into a separate YPD broth to ensure ~200 colony forming units (CFU)/mL. 1 mL of this suspension will then be spread onto the surface of the plates and incubated at 37°C to maintain its yeast form. Two plates from each group will be tested at 12 hrs., 24 hrs., 36 hrs., 48 hrs., and 60 hrs. after inoculation. This test will include counting the number of colonies for a growth assessment and running a reverse transcriptase qualitative polymerase chain reaction (rt-qPCR) assessment. The mean number of colonies will be calculated for each group. The growth rates will then be calculated using the equation: Rate = change in number of colonies / time . These results will then be placed into a line graph for clarity. The procedure for the rt-qPCR will be imitated from a similar study performed by Humidah Alanazi, Abdelhabib Semlali, Witold Chmielewski, and Mahmoud Rouabhia in 2019. Firstly, RNA will be extracted and converted into single-stranded cDNA using a purchased High-Capacity cDNA Reverse transcription Kit. The reactions will be prepared by combining the sample RNA with the 2X RT master mix (provided by the kit) and then placing them into the thermo cycler where the cycle conditions include: 10 minutes at 25°C, followed by 120 minutes at 37°C, 5 minutes at 85°C, and then cooling to 4°C. Next, these cDNA samples will be combined with purchased synthetic nucleotide primers (Table 1: SAP2), and a purchased SYBR Green Master mix in order to run the rt-qPCR. The rt-qPCR cycle conditions include: 5 minutes at 95°C, followed by 30 cycles of 15 seconds at 95, 30 seconds at 60, and 30 seconds at 72°C. Finally, the comparative Ct Method of rt-qPCR will be implemented to analyze these results. This method compares the differences between the SAP2 gene Ct values of each sample against a reference gene (Table 1: ACT1) that expresses at a uniform level. The mean of these differences will then be calculated for each group and compared using a one-way ANOVA test. Table 1. Primer Sequences Gene Primer Sequence (3’-5’) Tm(°C) Amp Size (bp) SAP2 Forward: TCCTGATGTTAATGTTGATTGTCAAG Reverse: TGGATCATATGTCCCCTTTTGT 54 82 ACT1 Forward: GACAATTTCTCTTTCAGCACTAGTAGTGA Reverse: GCTGGTAGAGACTTGACCAACCA 57 87

A Correlation Study of ACEs, BCEs, and ASD

Epigenetic factors play a role in gene expression in the offspring of affected parents. At present, no single environmental condition or genetic link has been found to produce humans with a diagnosis of Autism Spectrum Disorder (ASD). Results of this research will help future study efforts in determining the exact cause of ASD worldwide. This study will examine environmental conditions of parents during their childhood to determine whether there is a correlation between benevolent and adverse parental conditions and a diagnosis of ASD in offspring. It is known that there are genetic factors that can play a role in the development of ASD. To eliminate the element of genetic heritability as the cause of ASD, one questionnaire will be supplied which requests information on social personality preferences which would then screen parents for broad autism phenotype, which would signal a possible genetic inheritance as the cause for their child’s development of Autism Additionally, participants will complete two more surveys which asks questions about negative experiences during childhood and positive experiences during childhood. This data will be coded and analyzed using statistical software SPSS to determine if there is an epigenetic link between parental childhood treatment and the production of atypically developing children. This epigenetic effect has already been studied and demonstrated using mouse models and fear conditioning.

Impact of Plant Species on the Microbial Community of an Aquaponic System

Aquaculture, Hydroponics, and Aquaponics Aquaculture is the term used to describe the breeding, raising, and harvesting of living organisms in an aquatic environment (US Department of Commerce, 2019). “Fish farming” is often a common term. A common example of this is recirculating aquaculture system (RAS). While systems may vary, the concept remains the same. The water that holds the fish circulates out along with any waste or leftover food. It is then brought through a filtration, then an aeration unit that will return oxygen to the water and remove carbon dioxide (Losordo, et. al., 1999). Fish are not the only organism that can be raised as algae, seaweed, and other aquatic plants can also be grown. Hydroponics is a similar concept, however terrestrial plants are produced. It includes growing crops in water rather than soil (Tripp, 2014). Fertilizers, including vitamin and minerals are added to the water to ensure the plants have what is needed for growth. While both hydroponics and aquaponics provide significant advantages, specifically when addressing overconsumption of our food supply, recent studies have shown that a combination of the two could provide an even greater benefit (Junge et al., 2017). Aquaponics, not to be confused with aquaculture, integrates the recirculation of water and aeration of a RAS but uses the terrestrial plants and nitrifying bacteria from hydroponics to rid the system of waste products harmful to the fish. The fish will produce nitrogen waste in the form of ammonia. This ammonia is then broken down into nitrite and then nitrate by the microbes. A buildup of ammonia or nitrite can be harmful to the fish however nitrate is relatively harmless. Nitrate is also the preferred source of nitrogen for plants (Rakocy, et al., n.d). In the end the plant, fish, and bacteria all benefit. Microbes in the System While all components of the system are important, this study will look specifically at the microorganisms. Hydroponics, like aquaponics, often use nitrifying bacteria to produce nitrate, so it can be assumed that the microbiota will be similar, however it is unclear on how the aquaculture aspect will affect these microbes. It is not unlikely to find plant growth-promoting rhizobacteria (PGPR) in a hydroponic system. Rhizobacteria are the bacteria that grow directly on the edges of the roots. This means that they have direct contact with the roots. They maintain a symbiotic relationship and help promote plant growth accomplishing one of the following: reducing nitrogen into nitrate, enhancing stress resistance, stabilizing phosphate and potassium intake (Cakmakci, Donmez, and Erdoan, 2007). While they are extremely common in soil, PGPRs are also used as a biofertilizer to help plant growth in both hydroponics and soil grown crops. It was specifically found that Bacillus spp. Gliocladium spp., Trichoderma spp., and Pseudomonas spp. were common bacteria and can be found in a healthy hydroponic system (Lee, and Lee, 2015). All the previous species are also considered Rhizobacteria. Each species benefits the plant differently. For example, one distinction of Bacillus spp is that some species lowered the infection rate of some pathogens (Nihorimbere et al., 2011). In addition, specific species were reported to increase water quality and growth rate (Nihorimbere et al., 2011). Some species of Pseudomonas spp. were shown to decrease root rot and have some antifungal properties on certain species (McCullagh, et al., 1996). Now turning the attention to the aquaculture side, one study found that two main types of bacteria were found: autotrophic and heterotrophic bacteria. Many autotrophic bacteria were ammonia oxidizers such as Nitrosococcus, Nitrosospira, and Nitrosomonas or nitrate oxidizers such as Nitrobacter and Nitrospira (Rurangwa and Verdegem, 2015). These oxidizers help reduce the amount of ammonia and nitrite (that are harmful to the fish) into nitrate or nitrogen gas that are much less toxic. The heterotrophic bacteria were found to be different depending on the species of fish. For example one study using carp found Alphaproteobacteria and Betaproteobacteria. Later the same group used goldfish instead and found a larger variety of microbes that included Actinobacteria, Bacilli, Gammaproteobacteria, Planctomycetacia, Sphingobacteria, Hyphomicrobium denitrificans, Rhodovulum euryhalinum and Nitrospira moscoviensis (Sugita, et al., 2005). Advantages of Aquaponics/Implications and Relevance Food security is becoming an increasingly relevant topic globally. The United Nations Food and Agriculture Organization (FAO) estimated that by 2050, the global population will reach 9.1 billion and our agricultural system allone will not be able to supply enough food (Sohngen, 2017). In addition, studies have shown a great decline in labor in agriculture (Christiaensen, Rutledge, and Taylor, 2020). Finally, as the amount of people going into agriculture decreases, it was also found that those going into the agricultural sector have less knowledge than previous generations (Kuiper, Shutes, Van Mejil, et al., 2019). Without the proper knowledge and understanding, a series of trial and errors will occur that could have been prevented. Now that we are aware of the problem, it is now time to come up with a solution. Aquaponics, as previously mentioned, recirculation of water along with the aeration of a RAS but uses the terrestrial plants and nitrifying bacteria from hydroponics to rid the system waste products harmful to the fish. The end result would be both a supply of fish and produce grown from the plants. Aquaponics also has a multitude of other benefits. Some agricultural policies such as pesticides, fertilizers, and over use of soil have shown negative effects on the environment (Goudie and Viles, 2003). Aquaponics recirculates the water and only produces organic waste that is easily broken down (Konig, et al., 2016). This makes aquaponics an eco-friendly solution. As well as being an environmentally friendly solution, it is also economically friendly. The largest cost of maintaining an aquaponic system in a commercial style system was fish food (Konig, et al., 2016). The aeration unit, bacteria, and plants contribute to make the water reusable for the fish meaning the cost of water significantly decreases. Finally, aquaponic brings forth the idea of having a local food source rather than having dependence on food being brought in. This dependence can be seen currently in the pandemic. Studies have shown that because of travel restrictions, some consumers are no longer able to visit their typical spot nor were their typical products available (Laguna, et. al, 2020). It is also predicted to see an 17 million increase in food insecure Americans in 2020 compared to 2018 (Gundersen, et al., 2020). If used accordingly aquaponics could help reduce the dependence on transported goods. Aquaponics could be one part of solving the problem of food insecurity. It has shown to have great promise in multiple aspects economically, environmentally, and even more so in food sustainability. However, its full potential cannot be reached without a thorough understanding of the system. Abundant research has been done on the microbial ecosystem of hydroponics and aquaculture, but little has been done in aquaponics. Traditional aquaculture does not typically look into the microbes of the system. One of the main reasons being that DNA sequencing is very expensive to be proforme. In 2015, it was estimated that a whole human genome sequence would cost approximately $4,000 (Wetterstrand, 2020). This study will contribute to the knowledge on the microbial ecosystem. The objective of this study is to identify common microbes of an aquaponic system and to see if the type of plant has any effect on the microbes within the systems. The hypothesis is that while there are some microbes that are predicted to be the same, there will be a significant difference between the systems with different types of plants. Methods: Overview of setup Seven (7) five-gallon tanks will be used in this study. 3 tanks will have plant A (most likely basil), and 3 tanks will have plant B (most likely swiss chard). The remaining 2 tanks will be a control and hold additional fish respectively. These fish will be used as a replacement if one of the fish in the trial system passes on. All tanks will be cleaned with 20% bleach and thoroughly washed out with deionized water. They will then be air dried for 7 days to ensure that any left over chlorine is degraded. The figure below depicts a larger version of the system that will be implemented in this study. It will use a cylindrical tubing cut to look like a “C” to hold the plants grown in rock wool. A submersible water pump will be used to force water into the tubing. The tubing will be held at an angle to allow water to flow back into the tank. To speed up the growth of bacteria, nitrifying bacteria will be added as an additive (this is common in aquaculture). Three goldfish will be placed in each trial tank along with the control. The fish will be fed 1.2 grams of food. Measurements of temperature, ammonia, nitrite, nitrite, pH, chlorine, water hardness, and dissolved oxygen will be taken every Monday, Wednesday, and Friday before the addition of food to the system. This will be done to record and understand the health of the system while the microbiota is being established. This system will be allowed to run for 45-60 days. After the allotted time, microbial samples will be collected, and analyzed. This system was designed by a group of New Jersey students for the Lunar Plant Growth Challenge put on by NASA. Image Credit: Atlantic County Institute of Technology (Smith, 2009) Microbial Analysis In order to identify the microbes, the following procedure will be performed. A sample of water from each tank will be collected in a sterilized beaker. During transportation a clean tin foil cover will be used to prevent contamination. The samples will then be immediately filtered using a filter membrane with .45 micrometer pores. This is large enough to catch any organism, yet still be able to filter out any waste. The DNA will then be extracted from the filter by using an Illustra Bacteria GenomicPrep Mini Spin Kit. Once extracted, PCR will then be used along with a 16s microbiome kit that will help enrich and amplify the bacterial DNA. After this, DNA Clean & Concentrator™ Kits, Zymo Research will then be used to purify the bacteria and ensure that any leftover material from the PCR. Finally, DNA sequencing will be able to be performed and the data will then be analyzed to identify the species of microbes Data Analysis Once the microbes are identified, a series of two group t-tests will be performed. Since the data will not be numbers, some modifications will have to be made. To begin, each system with plant A will be paired with a system form with plant B. In all there will be 3 pairs. Then, all the found microbes will be placed on a spreadsheet. At this point, the microbes will be translated into 1 or 0 depending if the microbe was found in the system (1), or not found in the system (0). Each pair will then have a two group T-test run on them to see if there is any significant difference between the two. After the calculations are completed, confidence intervals will be used and a conclusion will be made. Timeline: Fall 2020: (current) prepare proposal, research, trial systems, present proposal Spring 2021: continue trial research (determining if this is the setup I want to us), practice jjjjjjjjjjjjjjjjjjj maintaining system (to ensure less problem during experimentation) Summer 2021: Work and earn money for project Fall 2021: Perform project, gather and organize data, begin analyzing results Spring 2022: take Bio 499, begin final report, senior presentation Budget: Fish: .25$ each $2 6 in one test strips: 100 for 15$ $15 Submersible water pumps with tubing $84 5-gallon tank 8 x 10 $80 DNA Clean & Concentrator™ Kits, Zymo Research present in lab 16s Microbial DNA prep kit present in lab PCR reagents $~50 ZymoBiomics DNA miniprep kit $274 Extraction filter present in lab Various glassware present in lab PCR machine present in lab Plastic petri dishes (40) $22 Nutrient Agar powder $46.30 Flow cell-NGS Nanopore $100 Overall price: $673.30 Any suggestions would be extremely beneficial, and I thank you for your time. Literature Cited: Cakmakci, R. Donmez, M. and Erdoan, Ü. 2007. The Effect of Plant Growth Promoting Rhizobacteria on Barley Seedling Growth, Nutrient Uptake, Some Soil Properties, and Bacterial Counts. Turkish Journal of Agriculture and Forestry 31:189-199. Christiaensen, L. Rutledge, Z. and Taylor, J. E. 2020) Viewpoint: The future of work in agri-food. Food Policy, 101963. Goudie, A. and Viles, H. 2003. The earth transformed: An introduction to human impacts on the environment. John Wiley & Sons, New Jersey, USA Gundersen, C. Hake, M. Dewey, A. et al. 2020. Food Insecurity during COVID ‐19. Applied Economic Perspectives and Policy 00, 00: 1-9 Junge, R. König, B. Villarroel, M. Komives, T. et al. 2017. Strategic Points in Aquaponics. Water. MDPI. 9(3): 10.3390/w9030182. Konig, B. Junge, R. Bittsanszky, A. et al. 2016. On the sustainability of aquaponics. Ecocycles 2(1), 26-32. Kuiper, M. Shutes, L. Van Mejil, H. et al. 2019. Labor supply assumptions – A missing link in food security projections. Global Food Security 25. Laguna, L. Fiszman, S. Puerta, P. et al. 2020. The impact of COVID-19 lockdown on food priorities. Results from a preliminary study using social media and an online survey with Spanish consumers. Food Quality and Preference 86, 104028. Lee, S. and Lee, J. 2015. Beneficial bacteria and fungi in hydroponic systems: Types and characteristics of hydroponic food production methods. Scientia Horticulture 195: 206-215. Losordo, T. Masser, M. and Rakocy, J. 1999. Recirculating Aquaculture Tank Production Systems A Review of Component Options. SRAC Publication No. 453. McCullagh, M. Utkhede, R. Menzies, J.G. et al. 1996. Evaluation of plant growth-promoting rhizobacteria for biological control of pythium root rot of cucumbers grown in rockwool and effects on yield. Eur J Plant Pathol 102: 747–755. Nihorimbere, V. Cawoy, H. Seyer, A. et al. 2011. Impact of rhizosphere factors on cyclic lipopeptide signature from the plant beneficial strain Bacillus amyloliquefaciensS499. FEMS Microbiology Ecology 79(1): 176-191. Rakocy, J. Masser, M. and Losordo, T. (n.d). Recirculating Aquaculture Tank Production Systems: Aquaponics—Integrating Fish and Plant Culture. SRAC-454. Rurangwa, E. and Verdegem, M. C. 2015. Microorganisms in recirculating aquaculture systems and their management. Reviews in Aquaculture 7(2): 117-130. Smith, H. 2009. Aquaponics. Retrieved November 01, 2020 from Sohngen, T. 2017. The World May Run Out of Food in the Next Decade: Study. Retrieved October 15, 2020 . Sugita, H. Nakamura, H. and Shimada, T. 2005. Microbial communities associated with filter materials in recirculating aquaculture systems of freshwater fish. Aquaculture 243(1-4): 403-409. Tripp, T. 2014. Hydroponics advantages and disadvantages. Pros and Cons of Having a Hydroponic Garden. Speedy Publishing LLC, Delaware, USA. US Department of Commerce. 2019. What is aquaculture? Retrieved October 06, 2020 from Wetterstrand, K. 2020. The Cost of Sequencing a Human Genome. Retrieved November 10, 2020.

Immunoglobulin Specificity Testing of Salmonid Species Using Rabbit, Rat, and Chicken Antiserum

Immunoglobulin specificity testing of salmonid species using rabbit, rat, and chicken antiserum Rachel Farina Lake Superior State University School of Science and Medicine Dr. Jun Li Fall 2020 Introduction In the Great Lakes region, several species of salmonid fish are naturally common in the wild and in hatcheries for research, breeding, and human consumption: lake trout (Salvelinus namaycush), rainbow trout (Oncorhynchus mykiss), brown trout (Salmo trutta), and atlantic salmon (Salmo salar). Immunological fish health is a very important topic discussed, especially in places where fishing is a main industry. Since these species of fish live in such large numbered communities, pathogens can spread rather quickly. Large amounts of disease, illness, and death in fish can economically harm the fishing industry greatly and reduce a common source of food for the human population living in this area (Magnadottir, 2010). As the fish industry increases, the immune system of these salmonid species must be studied fully, and laboratory reagents and practices must be developed further. Most organisms have an immune system, and fish are the first group of organisms with both innate and adaptive immunity (Magnadottir, 2010). The immune system of any organism is composed of many different types of cells and proteins that protect the organism from pathogenic threats. The salmonid immune system depends on the innate immune system heavily for health, much more than adaptive immunity (Uribe, 2011). Complement, a series of soluble proteins, and neutrophils, cells with phagocytic capabilities, are some of the main innate defenses that are present in fish mucosal membranes to fight off and kill pathogenic organisms. The innate system does not have any long-term memory functions, but it can fight off any pathogens very quickly without needing specific antigen interactions (Ma, 2020). Usually, an organism gets infected with a pathogen and is never aware because the innate immune system kills the pathogen before it can become symptomatic, and thus the adaptive immune system is never activated. Salmonids do also have an adaptive immunological response that is long lasting, but slow to activate. Fish have B-lymphocytes and T-lymphocytes both, but no lymph nodes for all the cells to congregate and accelerate the production of antibodies (Magnadottir, 2010). A single antibody is a Y-shaped molecule with variable regions that allows different molecules to interact with a very specific antigen. B-cells in fish secrete antibodies in response to specific antigens from potential pathogens. Then, the antibodies find the antigens in the body and attach to them so other immune cells know what to attack (Owen et al., 2009). It is important to note, especially in the Great Lakes area, that the secretion of antibodies is temperature-dependent and the activity is lowered in cold temperatures (Dixon). IgM antibodies are the most present isotype in salmonids, but they are tetrameters, four Y-shaped units attached together, instead of pentameters, five Y-shaped units attached together. The pentameter IgM is found in humans and mammals (Magadan, 2016). The adaptive immune system needs to be activated by the innate system, so an organism would only produce antibodies to something that the innate immune system could not handle by itself. The adaptive immune system contains a memory system which prevents the fish from getting sick from the same pathogen twice and a faster immune response to familiar pathogens (Owen et al., 2009). Because of this, even healthy fish contain antibodies in their serum. Enzyme Linked Immunoassay Assay (ELISA) testing is a major technique in immunological laboratories. It tests for the presence of a specific antigen or antibody by using the opposite as a reagent. Antibodies are very specific and match with only one antigen with great specificity. The original serum and a known laboratory reagent are mixed together into a well and allowed to incubate so the antigen and the antibodies can bind together. In some cases, a secondary detection antibody is necessary, which is “a[n] antibody that binds a primary antibody that is not enzyme-conjugated” (Alhajj, 2020). This is the indirect ELISA test. Then, a color changing substrate is added, usually horseradish peroxidase (HRP), so the wells can be analyzed in a plate reader (Owen et al., 2009). The concentration of antibodies detected can be determined from a created standard curve using the absorbance readings. Antiglobulin testing is a procedure used in microbiological, virological, and immunological laboratories. It is used to detect the presence of antibodies in one species by using the antiserum of another species. Purified antibodies from the original serum that is being analyzed are injected into a secondary species, where the animal’s immune system creates antibodies against the purified antibodies that were injected (Harmening, 2019). These antibodies can be used as the secondary detection antibodies in an indirect ELISA test (Alhajj, 2020). This can be used to detect the presence of a specific antibody in a laboratory setting and the minimum dilution that detects the antibodies. In this specific study, IgM antibodies were purified from the salmonid species, and anti-fishIgM IgG antibodies were created for the rabbit and rat, and anti-fishIgM IgY antibodies were created for the chicken. This study will test the specificity of each antibody-antiglobulin reaction between the four salmonid species and the three different antiglobulin producing species. Serum already collected from each fish species will be used for all specimens, and all of the antiserum is already created and is stored. These samples are from previous staff and students of Lake Superior State University. The study will determine which antisera works best to detect IgM antibodies for each salmonid species and the minimum dilution at which they are detected. Methods and Analysis The detection method to determine the specificity of each combination of specimen and antiserum will be done by ELISA testing. The salmonid IgM antibodies will be introduced into a well plate, and incubated for 15 minutes at room temperature to allow them to coat the walls of each well. Then, the different antisera secondary antibodies will be introduced to the wells, and allowed to incubate for 15 minutes at 37 degrees Celsius. Last, substrate will be added to each well, incubated at room temperature for 5 minutes, and observed for color change results. In between each step, the wells will be washed with 1x PBS three times to ensure accurate results. The plates will be spectrophotometrically analyzed by a plate reader at a 450 nm to test for specificity (Alhajj, 2020). I will use 96-well plates for analysis. Row A and B will contain control materials, with fetal bovine serum (FBS) as a negative control and Rainbow Trout serum as a positive control. The other columns will be replicates of each fish serum-antisera combination. Each has a series of dilutions, repeated four times: 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000. This setup can be seen below in Figure 1. The goal of this, is not only to see which antisera can detect the fish antibodies, but also to see the minimum concentration needed for detection. Creating laboratory antisera and isolating the antibodies for clinical use are both time consuming and expensive techniques. It is very resourceful to know what the minimum concentration needed is, so lab reagents can last longer and be used more. I plan to use an ANOVA test to determine if there are any significant differences to prove one antisera species binds more specifically to the fish antibodies than the others. Since there are two independent variables, a two-way ANOVA test will have to be performed. The specificity will be determined for all interactions, with two groups, or factors: fish serum species and antiserum species. There are four levels for the fish serum, and three levels for the antiserum species. This means that degrees of freedom is 3 for the fish serum and 2 for the antiserum species. Table 1: Treatment Groups Lake Trout Rainbow Trout Brown Trout Atlantic Salmon Rabbit Rat Chicken Each will have the exact same amount of replicates, four, and the averages determined by the plate reader will fill in the table listed above. A main effect test, interaction test, within variation test, and an F-test will be run using a two-way ANOVA test to determine significance of this study. If there are significant results, this project may develop farther. References Alhajj, M., Farhana, A. (2020). Enzyme Linked Immunosorbent Assay (ELISA). Statpearls. Dixon, B. The immune response in fish: A brief review. Received on 04 October 2020 from https://www.vin.com/apputil/content/defaultadv1.aspx?pId=11257&id=3863675&print=1 Harmening, D.M. (2019). Modern Blood Banking & Transfusion Practices. F.A. Davis, p. 103-110. Ma, S. (2020). Effects of environmental stressors on the innate function of Atlantic Salmon (Salmo salar). Lake Superior State Senior Project. Magadan, S., Sunyer, O.J., Boudinot, P. (2016). Unique features of fish immune repertoires: particularities of adaptive immunity within the largest group of vertebrates. Results Probl Cell Differ. 57: 235–264. Magnadottir, B. (2010). Immunological control of fish diseases. Marine biotechnology, 12, p. 361–379. Owen, J., Punt, J., Stranford, S. (2009). Immunology. The Journal of Experimental Medicine, p. 660-663. Uribe, C., Folch, H., Enriquez, R., Moran, G. (2011). Innate and adaptive immunity in teleost fish: a review. Veterinarni Medicina, 56, (10): 486–503.

Team Superior Acoustics and Geophysical Solutions: A Method of Oil Detection in Bodies of Water Covered by Ice

Team Superior Acoustics and Geophysical Solutions is a senior research group consisting of three Mechanical Engineering students: ________; and one Electrical Engineering student: ____. The students in this group have taken coursework in Acoustics, Signal Processing, Vibrations and Noise Control, Research Methods and Electromagnetics to prepare for the research to be pursued in this project. The team intends to perform experiments to test a method of oil detection in bodies of water covered by ice with the purpose of detecting and mapping oil spills to assist in expediting the clean up process. There is little research available in this area and due to the close proximity of Lake Superior State University to Enbridge’s Line 5, a 4.5 mile long pipeline carrying oil through the Straits of Mackinac, this issue is of greater interest to students at the university and the wider community. The proposed method involves hydroacoustics and uses reverberation time to detect changes from a pristine state. The hypothesis of the method states that the rate, at which a sound field decays changes, based on environmental factors, and the effects of oil on the sound field are measurable. Testing of the method by this team will be done in a scaled tank environment and efforts will be made to implement the method in a full-scale environment. The team will also improve the scaled tank environment by obtaining a material that would adequately represent the acoustic properties of ice without requiring the generation of natural ice, permitting testing to continue when the outdoor temperature isn’t low enough for growing ice by exposure. An impulsive sound source will also be identified by this team to be used in both the scaled tank environment and in full-scale implementation. In order to mitigate issues encountered by future groups with full scale implementation, this team will also collect data from lake environments in order to analyze the ambient noise present to establish a sound floor and investigate potential passive sources. In lieu of using crude oil in a lake environment for testing, an acoustics software package will be obtained in order to perform calculations that will further validate the method. Documentation of decisions made, supporting research and processing code will be compiled for future students to continue validation and implementation of the method. This documentation will be presented at an academic conference and a paper will be published to contribute to the larger body of research in oil detection methods. The team has a budget of $1000 from the School of Engineering and Technology at Lake Superior State University which will be used to obtain materials to test as an ice substitute, research papers, make repairs to the small-scaled tank environment and make improvements on the current sound source used in the small-scale tank environment.

The Effects of PFAS on the Beneficial Gut Bacteria Lactobacillus Acidophilus

Perfluoroalkyl substance (PFAS) contamination has recently become a large topic of discussion (and action) across the nation, specifically in the state of Michigan. These chemicals have incited executive orders, action response teams, and state-declared states of emergency (MPART, 2019). PFAS are long, fluorinated carbon chains that were commonly used in industry from the 1950s until discontinuation in the United States around 2015 as food packaging, nonstick coating, firefighting foam, and an important component of teflon. During these years, these chemicals have found their way into ground water sources, and from there into the human body (Buck et al., 2011). Water sources have been tested and have been found to have much higher concentrations of PFAS, particularly perfluorooctanoic acid (PFOA) and perfluorooctane sulfonic acid (PFOS), than is considered safe. Measurements of greater than 30,000 parts per trillion (ppt) have been found in groundwater despite the legal cap for safety being placed at a mere 70 ppt (Reade et al., 2019). Recently, the Center for Disease Control has named PFAS “chemicals of concern” toward human health, as research has shown that they may be one of the causes of numerous diseases, including cancer, diabetes, infertility, and weakened immune system. They may also contribute to changes in the liver, thyroid, pancreas, and more, as the chemicals have a long half-life in the body and are present in serum.(Anderson-Mahoney et al., 2008) (Center for Disease Control, 2018). While PFOA and PFOS have been discontinued in the US, a new chemical has taken its place. Named “GenX,” 2,3,3,3-tetrafluoro-2-(heptafluoropropoxy)propanoic acid is now being manufactured to compensate for the loss of PFOA and PFOS. This chemical has been advertised as safe, despite causing symptoms of disease in lab rats (Shea, 2018). The creator company, Chemours, has endorsed and produced the chemical. Recent tests show that GenX is also present in drinking water and accumulates in the blood (North Carolina Department of Environmental Quality). The exact mechanism of the diseases caused by PFAS is still unknown. Research has yet to disclose all of the effects these chemicals may have on the body, and how they are caused. One potential mechanism of disease may be through disruption of beneficial bacteria in the gut. The human body is known to have a large variety of flora, particularly consisting of a variety of bacteria, that have been shown to play a crucial role in human health, and damage to the microbiome has been linked to cancer, liver disease, diabetes, and more (Jandhyala et al., 2015) (Sekirov et al., 2010). Lactobacillus acidophilus is a species of bacteria found in the human gastrointestinal tract. This species has been shown to have major beneficial roles in human health: Lactobacillus has been shown to protect against liver disease, and increased numbers of the bacterium are also related to a lowered risk of colorectal cancer (Ritze et al., 2014) (Moore and Moore, 1995) (Guarner and Malagelada, 2003). Colorectal cancer is the third leading cause of cancer deaths in the United States, and is affecting ever increasing amounts of young people in the United States (Siegel, Jemal, and Ward, 2009). Because of this connection, killing these beneficial bacteria could be detrimental to the overall health of the US population (Zhong, Zhang, and Covas, 2014). Despite the small amounts of current literature on the subject, PFAS have been shown to disrupt the membrane bilayer of bacteria, and at high enough concentrations have been shown to damage and even kill the bacteria (Fitzgerald et al., 2018). Because PFAS are found in water, have been ingested by humans, and are even found in the blood, it is entirely possible that the presence of PFAS in the GI tract can interfere with or even kill bacteria in the gut, including the beneficial Lactobacillus. The death of Lactobacillus bacteria may thus be a causal factor in diseases such as colorectal cancer and liver disease. The purpose of this experiment is to investigate the relationship between PFAS and human health by determining the effect of PFAS on the beneficial bacteria of the gut. Three PFAS will be tested- the commonly found PFOA and PFOS, and the new GenX chemical. It is hypothesized that all PFAS tested, including the “safe” GenX, will have some inhibitory effects on Lactobacillus acidophilus, demonstrating a possible mechanism of disease in the human body. Methods: The effect of PFAS on Lactobacillus acidophilus was tested in two ways. One of these tests measured the zones of inhibition created by treating Lactobacillus acidophilus with multiple concentrations of PFAS. When a petri dish of bacteria is treated with a small disc covered in an inhibitory chemical and allowed to incubate, a circle of no bacterial growth will appear around the disc- this area is measured and is called a zone of inhibition. The larger a zone of inhibition is, the stronger the inhibitory effect was. The other test performed was a spectrophotometric assay that allowed for the growth of the bacteria to be measured. Each bacterial species has a characteristic “growth curve” that can be graphed when measuring absorbance of a bacterial sample over a long period of time. If the bacteria is treated with an inhibitory chemical, this characteristic growth curve will change. Escherichia coli was used as a control, as it has demonstrated sensitivity to PFAS in previous research. When compared, the data will show if Lactobacillus acidophilus may be even more sensitive to PFAS than E. coli. Zones of inhibition: 50 Petri dishes were inoculated with either Lactobacillus acidophilus or Eschericia coli. Diffusing discs were placed on the center of each plate, and each of the discs was treated with 40ul of either a high PFOA concentration, low PFOA concentration, high PFOS concentration, low PFOS concentration, high GenX concentration, low GenX concentration, or no PFAS at all. This was repeated in triplicate, so that 3 of each treatment group for each bacteria could be measured. These petri dishes were incubated at 37 degrees celsius for four nights, and any zones of inhibition were measured. Spectrophotometric assay: Six 50 mL tubes of liquid growth media were treated with either a high PFOA concentration, low PFOA concentration, high PFOS concentration, low PFOS concentration, high GenX concentration, or low GenX concentration. A 4 mL aliquot was removed from each of the larger stocks and transferred into a separate 5 mL test tube, for a total of 6 tubes. One additional tube of 4 mL untreated liquid growth media was also prepared. Into each of these tubes, 100 ul Lactobacillus acidophilus culture was placed. This process was repeated two more times, for triplicate measurements. The above procedure was followed, but instead of placing 100 ul Lactobacillus into the tubes, 50 ul E. coli was used instead, to allow for a control to compare Lactobacillus to. This created a total of 42 tubes. All 42 tubes were placed into a warm water bath at 37 degrees celsius, and shaken overnight. Beginning the next morning, the absorbance levels of the tubes were measured using a spectrophotometer at 660 nanometers wavelength. This was performed approximately each hour for 8 hours. The absorbance data was used to create a growth curve for the normal bacteria and each of the different PFAS groups. Data analysis: An ANOVA will be performed on the zone of inhibition data to determine which PFAS had the most effect, at what concentration, and which bacteria was most affected. The average growth curve for each treatment group will be plotted and compared to the “normal” growth curve to determine the effects of different concentrations of PFOA, PFOS, and Gen X on the bacteria over time.

Does Change in Location Affect the Frequency or Severity of Allergies?

The objective of my study is to determine whether there is a correlation between individuals that have moved locations from childhood and adulthood and have increased sensitivity to allergens. Allergies are caused by the immune system’s response to allergens. Allergens are one type of antigen which promote antibody production in the body. Allergens promote a specific antibody to produce, Immunoglobin E (IgE) antibodies. In the presence of IgE antibodies, allergy symptoms occur. These allergy symptoms are also classified as Type I Hypersensitivity reactions. In this study, the allergens that are being focused on are substances that are both foreign and harmless to the body and cause symptoms of hay fever. Hay fever symptoms include any combination of the following: runny/stuffy nose, itchy/watery eyes, inflammation of airway, headache, fatigue and phlegm. The most common types of allergens to cause these symptoms are pollen, dust, mold and dander. Mast cells, basophils and eosinophils are all types of white blood cells that are activated from the production of IgE antibodies. Increased numbers of eosinophils correlate with the presence of allergies; therefore, you are able to count eosinophils in blood samples and detect the presence or absence of allergies. A study conducted in 2012 showed that children living in urban cities had a higher prevalence of allergic diseases than children who lived in rural towns and villages. The children living in the urban areas also reported that they had experienced more frequent and severe allergies than the children living in the rural areas. To conduct this study, a minimum of thirty LSSU student participants will be needed. The participants will be assigned into groups according to their childhood residences. Half of the participants will be in a group with their residence being Sault Ste. Marie (SSM) and currently reside there. The other half will be in another group with their childhood residences from a location other than SSM but live there currently. This groups’ childhood residences must not be within 115-mile radius of SSM. Questionnaires will be provided to each participant pertaining to past hometown information and frequency and/or severity of allergy symptoms since being in SSM. Finger pricks and HemoCue white blood cell analyzer will be carried out and used in order to obtain blood eosinophil counts in each participant.

Examining the Correlation Between Variations of the ACTN3 Gene and Athletic Predisposition in Division II Student-Athletes at Lake Superior State University

In the scientific community, it has been widely accepted that elite athletic performance is a result of a combination of environmental factors and genetic makeup (Georgiades, 2017). Although elite athletic performance is dependent upon many different genes, this research will examine a specific gene, alpha-actinin-3 (ACTN3), also known as the “sprinter” or “speed” gene, and its genotypes (Pickering & Kiely, 2017; Del Cosa et al., 2019). This gene is of particular interest because it encodes the alpha-actinin-3 protein which is responsible for generating fast-twitch muscle fibers. Fast-twitch muscle fibers are responsible for generating high amounts of force quickly. Therefore, the variant form of the ACTN3 gene is common in elite athletes that participate in sports that require explosive power, such as sprinting (Ostrander, Huson & Ostrander, 2019). The ACTN3 genotype will be examined to determine its presence in Division II student-athletes at Lake Superior State University in order to understand if those student-athletes were predisposed to athletic success because of the ACTN3 gene or if their success was determined primarily through effort. Thus, we are examining whether nature predisposes Division II athletes the same as witnessed in elite athletes, or if nurture and training play a larger role in success. This study will take samples from athletes of both anaerobic (power and speed) prevalent sport student-athletes and aerobic (endurance) prevalent sport student-athletes to determine the degree of prevalence of the ACTN3 genotype. The information will be used to determine if there is a correlation between sport type and the presence of the ACTN 3 genotype in this population. This will be accomplished through the collection of DNA samples through cheek swabbing and subsequent analysis. Norman et al. (2014) conducted similar methodology. Purpose Statement: The purpose of this research study is to determine if there is a significant correlation between the presence of ACTN3 genotype and athletic predisposition in Division II student-athletes at Lake Superior State University. Relation to field of study: Nature, or genetic predisposition, has been proven to be a precursor to athletic success at the elite level (Pickering & Kiely, 2017) As the competition becomes stronger, the athlete must have nurtured their athletic talents, but they must also have similar genetic predispositions in order to truly compete (Ostrander, Huson & Ostrander, 2019). Thus, we see athletes selecting one sport to compete in at the elite level. This is not true at lower levels. At the high school level, it is common for athletes to play 2, 3 or even 4 sports (Bell et al., 2016). Some of these athletes may not play sports at the collegiate level. However, for those that do, they must rise to a new level of competition. It is not known if the level of competition at the Division II level is ‘elite’ enough in which genetics must play a role in order for athletic success. Thus, this study adds to the field of kinesiology by beginning to answer the question regarding nature versus nurture at the Division II level of competition. The answer to this question has much to offer in terms of training methodology and recruitment of student-athletes. Methodology: Upon approval of the HSIRB committee, student-athletes who participate in Division II athletics at Lake Superior State University will be asked to participate on a volunteer basis. Following the informed consent process, student-athletes from anaerobic and aerobic based sports (tennis, basketball, volleyball, cross-country, track and field and golf) will be asked to set up a time for DNA collection through swabs. No procedures will be performed until informed consent is provided to the participants. Student-athletes will meet the primary and faculty researcher in the genetics lab and complete a short demographic survey to identify gender and sport. Numbers will be used in place of identifying information. Following the demographic survey, the primary researcher will conduct a cheek saliva DNA swab. Following the DNA swab, student-athlete participation in this study will be complete. The primary researcher will immediately prepare the swab for DNA analysis to determine the presence of the ACTN3 genotype.